primer for dhfr codon 108 Search Results


t5 caption a7 primer name blasto fwd f5 ggtccggtgaacactttggattt 1641 1663  (ATCC)
91
ATCC t5 caption a7 primer name blasto fwd f5 ggtccggtgaacactttggattt 1641 1663
Primers used for PCR amplification
T5 Caption A7 Primer Name Blasto Fwd F5 Ggtccggtgaacactttggattt 1641 1663, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+for+dhfr+codon+108/pmc06389295-125-30-6?v=ATCC
Average 91 stars, based on 1 article reviews
t5 caption a7 primer name blasto fwd f5 ggtccggtgaacactttggattt 1641 1663 - by Bioz Stars, 2026-08
91/100 stars
  Buy from Supplier
dna extraction & primer design  (PrimerDesign Inc)
90
PrimerDesign Inc dna extraction & primer design
Primers used for PCR amplification
Dna Extraction & Primer Design, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+for+dhfr+codon+108/10__1128_slash_aem__03588___14-31-2-5?v=PrimerDesign+Inc
Average 90 stars, based on 1 article reviews
dna extraction & primer design - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
truseq 108 small rna rpi primers  (Illumina Inc)
99
Illumina Inc truseq 108 small rna rpi primers
Primers used for PCR amplification
Truseq 108 Small Rna Rpi Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+for+dhfr+codon+108/ppr0908028-61-16-22?v=Illumina+Inc
Average 99 stars, based on 1 article reviews
truseq 108 small rna rpi primers - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier
15xquas dtomato t2a gcamp6s  (Addgene inc)
92
Addgene inc 15xquas dtomato t2a gcamp6s
Primers used for PCR amplification
15xquas Dtomato T2a Gcamp6s, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+for+dhfr+codon+108/pm33049200-335-55-77?v=Addgene+inc
Average 92 stars, based on 1 article reviews
15xquas dtomato t2a gcamp6s - by Bioz Stars, 2026-08
92/100 stars
  Buy from Supplier
cpm g dna  (Thermo Fisher)
99
Thermo Fisher cpm g dna
Primers used for PCR amplification
Cpm G Dna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+for+dhfr+codon+108/10__1074_slash_jbc__m601110200-77-30-39?v=Thermo+Fisher
Average 99 stars, based on 1 article reviews
cpm g dna - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier
porous glass beads native cpg-500  (Prime Synthesis Inc)
90
Prime Synthesis Inc porous glass beads native cpg-500
Primers used for PCR amplification
Porous Glass Beads Native Cpg 500, supplied by Prime Synthesis Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+for+dhfr+codon+108/10__1128_slash_aem__71__8__4414___4426__2005-53-7-14?v=Prime+Synthesis+Inc
Average 90 stars, based on 1 article reviews
porous glass beads native cpg-500 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
random priming synthesis  (DuPont de Nemours)
90
DuPont de Nemours random priming synthesis
Primers used for PCR amplification
Random Priming Synthesis, supplied by DuPont de Nemours, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+for+dhfr+codon+108/pm09154157-43-18-27?v=DuPont+de+Nemours
Average 90 stars, based on 1 article reviews
random priming synthesis - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
fragment f5  (Bio-Rad)
93
Bio-Rad fragment f5
Primers used for PCR amplification
Fragment F5, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+for+dhfr+codon+108/pm17181873-87-17-10?v=Bio-Rad
Average 93 stars, based on 1 article reviews
fragment f5 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier
priming  (Danaher Inc)
86
Danaher Inc priming
Primers used for PCR amplification
Priming, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+for+dhfr+codon+108/pm09786938-99-15-20?v=Danaher+Inc
Average 86 stars, based on 1 article reviews
priming - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier
il 4 pe  (Miltenyi Biotec)
94
Miltenyi Biotec il 4 pe
Primers used for PCR amplification
Il 4 Pe, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+for+dhfr+codon+108/pm41176764-580-0-3?v=Miltenyi+Biotec
Average 94 stars, based on 1 article reviews
il 4 pe - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier
lactobacillus reuteri  (ATCC)
97
ATCC lactobacillus reuteri
Primers used for PCR amplification
Lactobacillus Reuteri, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+for+dhfr+codon+108/pm32236326-168-65-69?v=ATCC
Average 97 stars, based on 1 article reviews
lactobacillus reuteri - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier
lactobacillus reuteri atcc pta 5289  (ATCC)
96
ATCC lactobacillus reuteri atcc pta 5289
Primers used for PCR amplification
Lactobacillus Reuteri Atcc Pta 5289, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+for+dhfr+codon+108/pm31705683-95-15-17?v=ATCC
Average 96 stars, based on 1 article reviews
lactobacillus reuteri atcc pta 5289 - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

Image Search Results


Primers used for PCR amplification

Journal: The Turkish Journal of Gastroenterology

Article Title: The role of Blastocystis hominis in the activation of ulcerative colitis

doi: 10.5152/tjg.2018.18498

Figure Lengend Snippet: Primers used for PCR amplification

Article Snippet: The B. hominis Brumpt (subtype 1, ATCC®50752 ™ ) strain from the American Type Culture Collection was used as the reference strain in the present study. table ft1 table-wrap mode="anchored" t5 caption a7 Primer name Blasto FWD F5 GGTCCGGTGAACACTTTGGATTT 1641–1663 in {"type":"entrez-nucleotide","attrs":{"text":"AY244621","term_id":"37935750","term_text":"AY244621"}} AY244621 Blasto R F2 CCTACGGAAACCTTGTTACGACTTCA 1734–1759 in {"type":"entrez-nucleotide","attrs":{"text":"AY244621","term_id":"37935750","term_text":"AY244621"}} AY244621 Blastocystis probe FAM TCGTGTAAATCTTACCATTTAGAGGA-BHQ1 1705–1730 in AY244321b Open in a separate window Primers used for PCR amplification Statistical analysis Descriptive statistics are presented as frequency (n), percentage (%), median (minimum-maximum), and mean±standard deviation.

Techniques: